EST 1327776 is a singleton


Sequence

>1327776 (1 EST) Length=246 CGAGTAATATTGGTTTAAAACAATTGACAAGTGCCAATAATACCATCACTAATGATATAACACCTTCAACTAGATCACAG CCTACAAGTGAACATTGTTGGGATCAAGAAGATGATTTATCGGATATTGTTCTACAAAATGAAACCGATAAAATGGCTGA AACCGATATTCNCTCCGTCCCNTTAATGAACCAGAANTATTANTGCTGTAATGCTGCCAAATGATCATCCGTCAATAACT TCAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1327776: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277762552113AA629502MU000082.Y2RSmL


Date: 23:23:13 on Fri 17 Nov 117.