EST 1327777 is a singleton


Sequence

>1327777 (1 EST) Length=468 CGGCACGAGGCTGATCGAACTGTTGCATTATGGGATTTACGTAGTTTACAAATGAAATTACATTCATTTGAATCGCATAA AGATGAAATATTTCAAGTTCAATGGTCACCACATCATGAAACTATTCTTGCTAGCTCCGGTACTGATCGACGTCTACATG TTTGGGATCTTAGTAAAATTGGTGAAGAACAATCAGCTGAGGATGCTGAAGATGGACCACCGGAATTACTATTTATTCAT GGTGGACATACAGCGAAAATTTCAGATTTTTCATGGAATCCAAATGATGCATGGGTTATTTGTTCCGTATCTGAAGATAA TATATTACAAGTGTGGCAAATGGCTGAGAATATTTACAATGATGAAGAGCTTCCATTGACCATTGAAAATGAATAGATTT ATATCCAATATGCATTTCACACATTTTTCAATTTTTTTTATCTACACATCAATAAACTGTCATGTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1327777: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277772552114AA629503MU000089.Y2RSmL


Date: 13:3:8 on Sun 19 Nov 117.