EST 1327782 is a singleton


Sequence

>1327782 (1 EST) Length=256 GGAAAAAAAGCTATCGAAGAAAAACAGAGAGGATGTTGTCCGCGAACGAACTAAAAAGGTTGCTGACTACGAATCAACGA CTTTCTCAATATTTTACAATAATTGCCTATTTCTCCTAGTCTTACTGTTACTTTCTGCTGTTCTTCATCATTTCTCAAAT CAAGTAAATTACTCTGTATCAATGTTACTCGCTGCCGGCGCAACTGCTTTCTTGTCATCCGGAAAAGGATCATTTTGATT CCACATGTAATATACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1327782: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277822552119AA629508MU000114.Y2RSmL


Date: 4:20:37 on Thu 23 Nov 117.