EST 1327783 is a singleton


Sequence

>1327783 (1 EST) Length=489 GGGNAATAGTATTTTACAAAATGTAATGATTTTNCAGGTCCAGCACTTTTCATATTTAANTGTNAACATCCTAAAAGACT GGTTTCCTGCATTGAAAAACGAATAAATTCTCTCTTGCATCTGTATCGAAATATGACGTCTGTCATAAAATATTTGCATC CAGTACGAGAATCGTGTCTAGATCGCAAAGAAACTTACTCATCATCAAGATCAGAACTCGAAATAAGATCAATTGGTTTT TCCAACTCATTAAATAAAGAAAATGAAGAAAAATCTCATTCGATTGAATCTCTCCGATCTCCGTCATCTGTAGTGTTCAT TTGCGGTCCAGATGACTATCTTCTGCCACGCNATATNTCTGAGCANAACACGCTTNATTTTGATCCTGTTACNGAAATGC CTGATTCTCGTGTAGAATTATCATCANTTAGACAGATACTTTTAGATCTTNCCCTATGGAAACTACCTTGAAGCTGCCCT TGCTCCTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1327783: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277832552120AA629509MU000115.Y2RSmL


Date: 12:4:7 on Fri 24 Nov 117.