EST 1327786 is a singleton


Sequence

>1327786 (1 EST) Length=278 CGGCACGAGGTTTTGTTCTTTTGAGCTGGATGGTTTGGTCCATCCAGTTCAGAGACTTCATCAACTAATCATCCACCCAA GGTACAAATCTTCTACATCATCTCAAAATGATTAGTTGTGAAAAAAAAATTAGAAAAAACAAAAATAAATAAATCAATTT ACATTTTTGCGTGCGTGTATGTGTGTGTGAATTTACTTTGACNATATATTTTTTTGCTTATTATTATTTTCTTTTCCTTT TTTTCTAAAGTAAATATTGATTAAAGAATAATCATTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1327786: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277862552123AA629512MU000131.Y2RSmL


Date: 15:54:21 on Fri 17 Nov 117.