EST 1327788 is a singleton


Sequence

>1327788 (1 EST) Length=313 CGAGTAACATTGTCGACACACAATCCATCCATATTTATTATATTTTCTAAATANACAATTATTATNGTAAATTACGTGAT CAANGGTTCCCACTATAATATTTGTGTTAATATAAATTGCTTTTTTAATCGGTATTTGGTCAACACAAATTTATAANTCT CCCTTCCCCCACCTTCCCCCCTTCCTCCCTCTCTCTCTCTCTCTATCTCTCTCTCTTATTGTTGTCATTACTATTTCCCT GTCANNCNTCCCCANGGTATGCGTATTTCTTTATTTTATCAATTGTGATTTGATTGCATAAATTTATGACTAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1327788: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277882552125AA629514MU000133.Y2RSmL


Date: 4:26:15 on Fri 24 Nov 117.