EST 1327789 is a singleton


Sequence

>1327789 (1 EST) Length=478 GGTTTAAATTTACTGTAATTTAATACTTTTGATTTCTCCTCATTTAAATAATCTTTTTTTTCTTTTTTTTCACTTCATTT TTAACTTTTTCATTGTCTTATCCAATGAACTAACATTTGTTTNGTTTGTTTTTATCAATTTCTCACTATTATATAACTAA GAGTTTTTTNGTTTATTTTTCATGTTTATAAAATAAAACAAACAAACAAACAAAAAGAAGAAAGAGAAAACAGTATTAAT ATTCTCTCATTTTATTTAAAAATAAATAAATAAATAATATTTAAAACTGTATGATATCTTGTATATTAATCAATAATATG TGATAATTTAAATTTGAATAATTAATTATTGGATCGATTATTTTATTCTTTTATGTAATTTTGTTTGTTTTTTTNCTTTT ATTTTCGATTTCAATCAATAATTTCGTTCTACTTTTTAAAAAAAACAAATCAATAAATCAATAAAANAATAAATCAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1327789: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277892552126AA629515MU000135.Y2RSmL


Date: 11:25:16 on Sun 19 Nov 117.