EST 1366634 is a singleton


Sequence

>1366634 (1 EST) Length=158 TTAAATAACAAACATCATCAAAAGTTGAACAACAGAACCCAATAGCACCTGCCAATGAAAATGAATCGATGTTCCATTAC AGCTCAGAAAATGATTGTTGATATAAAATAGCTAAAAGTAATTTTTACAAATAAATACAAGTGACCTCATACTGTTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1366634: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13666342605172AA661128MB3D6V3A06T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 1:4:7 on Tue 21 Nov 117.