EST 1366711 is a singleton


Sequence

>1366711 (1 EST) Length=181 CTCATACAAAAAGCCGGGATAAATCATGTGTAATCCTCCGATAATCACTCCTTCATCGTCATTCGAATCTATTTCTTCCT ACTCGCCATCCTCCTCGTTTAGTGATAAAAGATATAACATCAGACGAGGAATGAGTTCAAATCCATGTCGAATTCATTCG GTAAACAGAATCACTTTCTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1366711: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13667112605249AA661205MB3D6V4B01T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 14:3:22 on Mon 20 Nov 117.