EST 1366752 is a singleton


Sequence

>1366752 (1 EST) Length=215 CTCGTGCCGGTGGACGCCAACCCCTAACAAGGGTAAACTGTAAATGAAAATAGGTGAAAATTCACTGGTGTTTTGTGTAA ACTTCTTGTACATCATGGAAAGGGCTTAACATGAAGAAATTTATTTGACTTGTTGTCCCTTCTAATATTTCACATAATTC ATGCACATTTCTTGCATATTATGATTAAAACGAAAAAGATTATTAATGAATTTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1366752: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13667522605290AA661246MB3D6V4F02T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 10:55:28 on Tue 21 Nov 117.