EST 1366776 is a singleton


Sequence

>1366776 (1 EST) Length=217 GCGTAAGTATTCTTTTGAGTAATTTTTTAAATGAGGAGACTATATTGTACCAGGATATACTTCCACTTATCTCCATAAAT CATTTTGGCCGCTTGCATTAACGCTTCATTTTGAAACACTTTCATTGTTCCTAAAGTCAATAGTGCGAAACATGGTTGCT AACGTTGTCAGTTGTGGAGCAAATTGGTGTTGGATAAATTAAAAGTTGTGGAGTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1366776: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13667762605314AA661270MB3D6V4H09T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 6:10:0 on Wed 22 Nov 117.