EST 1366810 is a singleton


Sequence

>1366810 (1 EST) Length=181 TATAACTCAAAAAATAGCAGAACTCCGTTTATTCTCACAAAAATCGAAATGGGTTTCGCCAAAAACTCGATTCAGGCCGT GCTGAAAAAGAGATCGTATTTTAACAAAATCAACGGGATCAAAAACTTCAGCGCCGCGCCTCAGAGTTCTGCTGCTGTTG CTTCTTCCACTGATGAACTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1366810: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13668102605348AA661304MB3D6V5D01T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 14:13:53 on Fri 17 Nov 117.