EST 1366832 is a singleton


Sequence

>1366832 (1 EST) Length=325 ATATTGTTTGAAATGTATAGATGTATTGTTCTATGAGATTTATATTTTATATATTCTTACCAGCGTTGTATAGTAATTTA AATCAATCTCTGGTACTTCATTTAATCGTAAAAAGTTTGTGCAAAGGATATGCTCGTTTCATATGGTTGTGGCCATCTTC GTAATTGCTTTGATATCTGGATCCAGGAATATTTTTTCATAATTGCCGTTAATTACCATGTTGGCTAGTAGGAAGTAGTT TAGCCTTTTCAGAACGAATTTATTTGGTAGAACTGGTTGTATTGGTTGTATCACGTAGGATTTATAAATCATGGTTTAGT GTCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1366832: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13668322605370AA661326MB3D6V5F08T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 11:41:41 on Fri 24 Nov 117.