EST 1366905 is a singleton


Sequence

>1366905 (1 EST) Length=471 CAAGAGTTGGTGGAGAGGGTGACGCTGTACCTTTTACGATTATCGAAAATGGCTGCCCACGTTACCCGGCCCTGGTTGGC CCCGTTCGACAAGATTTTGAGAAAAACCGCCTCAAATGTGACATGAAAGCATTCCGATTAGATGGTTCCTACGACGTTCA AATTTTATGTCAAGTAATGTTTTGTGCTGGACCTAATGGATGTCCACCGAGTAACTGTTTGGATTCTGGAACGAATGAGC TGTTTATGTCTCATGGACGGCGGAAACGAAGTGTCGATGAAAATGATCAAACAGAAGGTACACTGTCTGCAATAATACGA GTTCTCGCAAAAGGAGAAAACGAAGAAGTTTTACAAAATGCTACCTTCCCAAATAACACTTTTTCGGAAGAATTCGACCT GGTGTGCATGTCTGAGGTGTGGTTCATTTCATCAGTCGTGTCCGTATCTGTGGTATGCTTGATTCTATCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1366905: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13669052605443AA661399MBAFCW3E10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:12:49 on Sun 19 Nov 117.