EST 1366927 is a singleton


Sequence

>1366927 (1 EST) Length=460 GTTTTTTATTACGTTTTAGCACAATTTTTCACCTATATCGAAAATCATTCGGTGGTTGAGATTATGAATTTATGCCAAGA GCAATTCAGATTGGTAACAGAACGAGAAAGAGGAAAAAATTCTCGATTAAGTTCGGTTGAGAATGTCAAGGTTCGCTTAC GTACAACTGCTTATGAACTTCTGAAATACTATGTATACTTTCAAGGAATTTATACTTCTGAGGTTTTAATACGTAGTATA GAATCTCAAGATTGGATAAGTTATGCCGAACCAACAGCAGTGCGATCAGCTGTAAAGTATTTTATCAATAATTTAGCTTC CATCGATTCATCTATTAAAGTTTTTATGGATGAAGGTACTCGTAAAGAACGATTGTTAGAAAACAGTTCATCTCGATCAC ATTCAAGGCAAACATTGGATACATGTCCAATCAGCTCAACACTGGATAAATTATGGTCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1366927: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13669272605465AA661421MBAFCW3G09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 18:19:45 on Fri 17 Nov 117.