EST 1366937 is a singleton


Sequence

>1366937 (1 EST) Length=312 CAAGTTTGAGGGGAAGTGGATTCACAGGTGGACAAGGAACAGCAGAAATAGCCGCTAGTTCAATTATTTCTAGAGAAGAT GTTGGGTTTGAACAAAGAAATTACGTACAACAACCAACCGGTAAGCGTTTGCGTATAGACGATAGCTGCTTCGATACGTA TGGCGCTGGTGCTTTCAGTTCAGCTGAAAAAGTTTGCAAATCTACGGAGAAAGAAAGAAACAGTGAAAGTTGTATCCAAG GTATGACACCGAAAGGTTGGGGACAGTTGCCATCCGCCACTACTTTCAGTACATTTTTGATGGATGATCGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1366937: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13669372605475AA661431MBAFCW3H09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:8:36 on Thu 23 Nov 117.