EST 1381308 is a singleton


Sequence

>1381308 (1 EST) Length=407 CATAATTCGATAATCTCTATGGGATTCGAGAGTCACTACCAGATGGTATCAAACGAGCAACAGATGTAATGGTTGCTGGA AAGGTTGCCGTTGTAGCAGGTTACGGAGACGTTGGGAAAGGAGCTGCTGCTTCATTAAGAGCATTTGGAGCACGAGTAAT TGTCACTGAAATTGATCCGATCAACGCTTTACAGGCTGCTATGGAAGGATATGAAGTTAAACCTTGGAACATGTAGCATC GGTAGCAAATATCGTAGTCACTACAACTGGTTNGCAAATGCTTGTTCGAAAAGAACATATGATTGAAATGCCCGAAGATG CAATTGTCTGCAATATTGGACATTTCGATGTTCAAATTGATGTAAATTGGTTAAATACCAATGCGATAAGCCGAGATACA ATAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1381308: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13813082655428AA675722MBAFCW4A06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 6:12:3 on Wed 22 Nov 117.