EST 1381320 is a singleton


Sequence

>1381320 (1 EST) Length=404 GAATCACTACGGTGTATTAAGTTGTGAAGGATGCAAAGCGAAAATATTTCAATTACAAAAAGTTAAAAAAAGACGACAAA ACCATGAATATCAGTACAAGGGATTATCGGACAAAGTAATTGGAAAGTCGAAGGATCTATGCGTTGTTTGTGGTGATATT GCATCCGGTAATCACTATAAGGTGTTAACCTGTGAAGGATGTAAGAGTTTCTTTCGACGAAGTATACAGAAGAAAGCANA ATACCATTGTGTTAGGAGTGGCAATTGTCCAATAACGGCAAAGGATAGAAATAAGTGTCAGAAATGTCGCTTGGATAAAT GTGTAAAGAAGGGAATGGATGTAAATTCTGTGACTATGAAGCAATAAATATAGTGTCGATATCTGGATGAAATCAAAACG CTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1381320: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13813202655440AA675734MBAFCW4B07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:30:28 on Fri 24 Nov 117.