EST 1381329 is a singleton


Sequence

>1381329 (1 EST) Length=315 AGTTTACACAAACCTCAAACTTTCAGCAACCGGATACTAGATCTGCAGTATACCGCAGAATGAAACAACGAATTCAACTA ATGGTTACGTCATCCCGTCTGGGAACTATAATGGGGTGCAGTCGTATCCACAACAAACGCGCTTGCCTGATGTACGTTAT TGTGATAGATCTTATTACGGTAACGAATCAGCCAACAATGGGCAATCACGTTTAGCTTCACGTACTACAGATGAGCTTTA TCCAGACAGTTCAACAGATAACAAGCCGGCATTATGCAAGGTATGTGGTGACAAATCGAGTGGCTTTCATTATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1381329: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13813292655449AA675743MBAFCW4C04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 6:47:43 on Tue 21 Nov 117.