EST 1381341 is a singleton


Sequence

>1381341 (1 EST) Length=480 TTGAGCTACCAACAGAAACGATTAATCGATACTAGTTATGGCTAATGTCGATTTGCAATGTACGGAAGCATCTCAGCAAA CGATCAGTGAATATTCACGGCGAGAACTGAAGGAGGCATTTTCAAAATGTGATCCAGAAGGCACCGGAGTTACATCTATC AAAAATCTCAAGACTATTCTTCGATCACTTGGTTTCGAACCACGAAATGATGAAATAAGGATTTTAACAGAAAAAATTGA AGGATATGGAAAACAACAAAAAGACAAAGTCACATTTAGAGAGTTGAGTAATTTGTTGAGCGAAAAGTTAGATGAACGTA ATGGGATCAGAGAAATGCATGCTGCTTTTGAGCTGTTTGATTCCGATTTCAAAGGATATATTACAGTTGATGATTTACGA AGAGTCGCTGGAGAACTAGGCGAAACAATAGCAGAAGACCAACTAAAAGATATGATTTTGGAAGCTGATACCCGTGGTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1381341: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13813412655461AA675755MBAFCW4D06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:8:36 on Thu 23 Nov 117.