EST 1381361 is a singleton


Sequence

>1381361 (1 EST) Length=241 GTGACCACTTGCGAGTCGTATCGCATGCGGAACTGTTATTATTAAACCGAATGTAGCTCGTTTTACTGAACATGATGTGA TATTCGAAGATGGTACAGCGGTGTGTAATGTTGATGCAGTGATCTTTGGTACTGGTTATTCGTTTCAATTTCCAATCGTT GAAGATGGTAATCTCATACCTGTTACTGATAATAAAGTTGATCTATATCTGCATATATTTCCACCACAATTATCACCAAA G


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1381361: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13813612655481AA675775MBAFCW4F04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 11:58:49 on Fri 24 Nov 117.