EST 1381367 is a singleton


Sequence

>1381367 (1 EST) Length=297 GTGACCTTTGTCTTATCATTGCACATTATTTGTGTATATTTTATGATATCTTATAAATGCTTCCATGTTTTGAGGTGAAA AAAGAAAAAAAAAGCAGGTTGGTTGAACATAGAAGAAAAATTATTTTTCTTTCACCAATTGGTGTGAATCGTTATGTTTC ATTCTGATGTACGCGTTTTATTTTCCATAAATGAAAATGCCCAGCATTAAAAAAAAAAACTCGTGCCGAATTCGGCACAA GGTTTACTTAGCTACCAAAATCGCTTAAAAGGTAACGTAAAAAATAATGCAAATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1381367: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13813672655487AA675781MBAFCW4G01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 22:59:49 on Wed 22 Nov 117.