EST 1381410 is a singleton


Sequence

>1381410 (1 EST) Length=531 TGCTACCTTAAAAGCTACTGTTTTTGTAAATGGAAGTGACAAGTGATGCTACAGACATTCTTAGTCAACTTTCGCCAGAA CAGGTTGAACAATTTCGGAAATACTTCAATATGTTTGACAAAGAAAACAAAGGTTTTATCAAGGCAACACAGATCGGCCA GATTTTAAGAACTATGGGTCAGGCATTTGAAGAACGAGATTTGAAACAGCTTATTAAGGAGTTCGATACTGACGGATCAG GTGAGATTGAATTCGAAGAATTTGCAGCAATGGTTGCTAGTTTTGTTGTTGAAGATGAAAATGCCGGTTTAGAGGAGGAA CTGCGAGAAGCGTTTCGATTGTACGACAAGGAGGGCAATGGTTACATAGCAGTATCAGATTTGCGTGATATCTTACGTGC GTTGGATGAAAATGTCTCCGAAGAAGAACTAGATGAAATGATAGCTGATATCGACACTGATGGTTCTGGCACTGTCGATT TCGACGAATTTATGGAAATGATGTCTGGCGAATGAGCATTGTTCGAAAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1381410: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13814102655530AA675824MBAFCW5C04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 17:19:4 on Fri 24 Nov 117.