EST 1381425 is a singleton


Sequence

>1381425 (1 EST) Length=130 GTCTCTCTCTCTCTCTGGCTCTCTCTCTCTCTCTCTCACGACTCGCGTGCTGTATCCATTATCGAAAGATATTGGTATTT TTTTGAAAATCCTCCGTGATCTGGATCGGGAATTGCAATTATTTCCCTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1381425: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13814252655545AA675839MBAFCW5D09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 5:8:3 on Tue 21 Nov 117.