EST 1381439 is a singleton


Sequence

>1381439 (1 EST) Length=271 GCTCGGGCCAGATGGAACAATTTGTTTGAGGTAATTTCGTGATGATTGGGGAATATAATTAGACTTGAGGGCTTGAAAGT TGACACGAGTCTCTTCCGTTTCTTTACAATGGCAATCAGGCAGCTGGGAGATTTATGCCGTGATTTGAATGGGATTGCTG GGGAACTGAACAATGCCGCACTTGTTGACAATCTTCGACTCATTCGACGACGTATCGAGAATGTATCGAAAAAAGCAGAG CAAAGTCCTTACTGGCGTGGACAAAAACCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1381439: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13814392655559AA675853MBAFCW5E12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 5:14:56 on Sat 18 Nov 117.