EST 1381444 is a singleton


Sequence

>1381444 (1 EST) Length=371 ATAACGTATAACGAAAATAAACAACTTCGAAATTCATTATCAGGCTGATGTTTGCGTCCTTTTGCTGCAGCATGGTGCTT CATCGCGGAGCGAAAATTCAGATGGTAAGACACCGCAAGATTTAGCAGATGGCGATGCTAAAGCAGTTTTTACAGAGGAC CTCGTGCCGAATTCGGCACGAGCGGTGGTTTAGCTGTTCGTCGAGCTTGCTATGGTGTGTTGCGTTTTATTATGGAATCC AATGCTCAGGGATGCGAAGTAATTGTATCCGGAAAGCTGCGCGGTCAGCGAGCTAAATCGATGAAATTTGTTGATGGATT GATGATTCATTCTGGTTCACCGGTAAACGATTACATCCAACAGGCAGTACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1381444: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13814442655564AA675858MBAFCW5F05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:44:48 on Thu 23 Nov 117.