EST 1381550 is a singleton


Sequence

>1381550 (1 EST) Length=393 CATCAAAATATAGATATATTTATCCTCAACGGCGTTCTCATTGGATTTGAACTTCAAAACAAAACAACAAAAAAAAAAAG AGTGAATAATCTTCTGCGCCGCTGGCCGAATCCTGAAATTTCCTGTAGAAACCAAAAACAAGGTATGAGAAAAAAAAAGG GGTTATCGCAGAGGTTGTTAATTGCCTCAATGTTTCCCTGCAATAATATATATTCTACTGACCGTTCGCATGGTCTTTTG TCCTCAGTTAGGATTTACATATCATTACTTACGACGTGGCAGACTTTTGGGGTCTTCCAACCACAAGANACCGCCGCGTG GTGGGGTATCAACAGGGGGTTGGGTNGGTGGCAAAAATANAAATAAAAAATACTCCTGGGCCCCTATTCGGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1381550: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13815502655628AA675964TENF0452T.cruzi epimastigote normalized cDNA Library


Date: 4:37:34 on Wed 22 Nov 117.