EST 1381551 is a singleton


Sequence

>1381551 (1 EST) Length=478 AAAACTGTTGAGTCAACATGTCGATTTAGATGTTTTGCAGTGTATGGATGTATCCGATCTAATGACCTTTGGTGTCTCAA ATAAATCCCATTGCCAAATGATTCTCGACGCCGCTTTGAGATCAGACACGGCGGATCCCGAAAATGTGGGCGGTGATGCG TTGGATGATTTTGACCCGAAGCTGGATATCCCTCTGGTAAACCCGTGGGTGGTGTAACACTAAGTGACGATGAGGACGAT GAGATTGATCTTTTTGTCCCACCTCAGAGGACAGTGACGCTGGACGAGGACTCGGATGAAGAGCTTCTCCCTTCAAGAAC CCCTGCTGTAAACGTGAGCTAACCACCAGCTATCGGTTATTGATGATGATGACCTTTAATATTACCTAGCGGGAAAAAGN AAATTGTTTTGGATATCTTTTGATTTTGNTTTTTTACATTTTACTGAATTAGGTTGACCGTACACTCATATCGGTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1381551: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13815512655629AA675965TENF0453T.cruzi epimastigote normalized cDNA Library


Date: 4:9:58 on Wed 22 Nov 117.