EST 1381561 is a singleton


Sequence

>1381561 (1 EST) Length=301 GAGCCACATTTAATGGCATGGTTCCAACATATAAACTACGAAAAATGAACTCCGCACTAGATTTAGTCTCGGCCATTATA TACTCCGTGGTGGAAAGTTTGGCTATTCGCACTCGTGGGCTGTGGCGATGTTATGGTTGCCACCTCCTGGGGTTGTTTCC ACGGAGCTTGTGGCACCTTTTGTCGTGGGACGTGACATGTCAAAACTCTGGAACTCTGCGCCATACCGCGTATCCGAGAA TTCTGTGCCGTGTCTTGTAAGTGAGACTGGAATTGCAGTGAATCTAAAACCATCTCAAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1381561: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13815612655639AA675975TENF0486T.cruzi epimastigote normalized cDNA Library


Date: 0:26:1 on Sat 25 Nov 117.