EST 1381562 is a singleton


Sequence

>1381562 (1 EST) Length=312 TCCCATTCCGCTCCTGGAATTCTCGCGAGCAGCAGAAGGTGGGGGCAGTGGCTGTTTCCACGGGAGGTGTACTCCCGGAA GCCGTCGATAGTGGGTGTGCTGAGGGGGCTTCACTTTCTCAGGGAGCCGCCAAGGAAGCATTGGGTCCATTCCCAAAGGA TGTTGTGATGGGGCAGGGGGATTTGGGTGAGGGAGGGAAGGAAGATGCCTTTGCCTTGCCGTTACCCTTATCGACAAGGA AAAGTGGTGGCTGTGATGACGAAGATGCTCCTTTATTTTGTCGAGTCACACCTGTTGGGCGGCGAGGTGCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1381562: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13815622655640AA675976TENF0487T.cruzi epimastigote normalized cDNA Library


Date: 10:2:59 on Fri 24 Nov 117.