EST 1381568 is a singleton


Sequence

>1381568 (1 EST) Length=274 CCCCCACTGAAGTTCATCATGAAGAGCAATATTCCTTTTGGGTGTGGGTGTGGCTCTTCTTCTGCCGCTGCTGTGGCAGG AGTTTGTTGCCGGGATGAAACTCTGCGGCCTCACAATGAAAACCGAAGAGGAAGAAGCTCTTCTGCAGGTGATTGCCAGA TTTGAAGGCCATCCTGACAATGCAGCCCCCGCAATTTATGGGGGTATTCAACTGGGTTACAAAGACAATAATGGCCGGNT TTTAACTTATTCGAGTTTCCCACACCCGCGTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1381568: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13815682655646AA675982TENF0493T.cruzi epimastigote normalized cDNA Library


Date: 1:48:49 on Sat 18 Nov 117.