EST 1381575 is a singleton


Sequence

>1381575 (1 EST) Length=392 CTCGCAGAAACCGCAACGAATACGATAATGTCCACGACAATAAACACGAATCTATGAACACGCCATCTGAACAAAGAATA CTTGTCGATGTTGTGGGCTGCCCAAAGCTTCAATCCATGGATAAGGACCATTGCACAGTGGAGTGGAATGGATCCTGCGC CTCTTACACGGTTCATTGGCGTGTGACTCCGACGGGTGCAATTCGTACAGAAACGGTCGTGCGTGACCAGGGCGTCGTCC CCAGTTGACTGTTGACATCCGTTCACTGCGATTCACAGTCGTATTGTTTTGTGTGCAGGGCGCAGTGGACGCCTCCAACT GTGCCCTTTTCACAGTACTGGTCCCGTTTATTCTGACCGGGGCCTCGGCTTTTGTTCCCATGACGAGGAGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1381575: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13815752655653AA675989TENF0500T.cruzi epimastigote normalized cDNA Library


Date: 22:24:5 on Thu 23 Nov 117.