EST 1381579 is a singleton


Sequence

>1381579 (1 EST) Length=529 TCAAAAATGTGGTTGATGTGTTTATTTTTACAACAGCAGCCATGTTCACAATTCCCATTGTTGTGCTTCTTTTTGGTATG CACGTTGTGGCGCCGTATTTTGGAGCCGATTCGGGTGTCTGTGGTGGGTTTATGGCTTTGGGGTCCACTATCGCGATCAT GGCAATGTACGTCATTTATGCCTTTTGGGAGCCTTTTATGGGTCAGTCCGCGGCGGGAATGATCGCTCAAGAAAAGAAGC ATCAGTAGTGAAACGNATTTTTTTGCATGACTGAGTATCATTACTATTATTATTATTATTTTTTGGCGTGATGCTTTTTT TTAAATGGGGTTGTTACTGTTTGTAATGTGTGAATCATAACCTTGTTTGTTAATGTTGTCATTTTCGAGGTGCGGTGATG GATGCAAATTTCCACCCCTTTGCCCATTCCGTCAATCCCCAACGCAAGGAATGAAAAACTGTGGTGGGCGTGGAAATTAC CAATTTGNGGCTGTGAAAAAAAAAAAAAAAAAAAAAGTTGCGGCCGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1381579: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13815792655657AA675993TENF0507T.cruzi epimastigote normalized cDNA Library


Date: 4:6:34 on Thu 23 Nov 117.