EST 1381595 is a singleton


Sequence

>1381595 (1 EST) Length=372 CTTTTTTCCCCTCCTTTTGTTTGAGCATGACAGTGAGGCTGTTTGTTTCCAGGCTTTCCAAGAGTGTCCCTGCGAAGGAG GTTGAGGAGTTTCTCGCAAAACTTTTCCCTGAGGCCGTTCATATTCAAGTTGCTGCAGGGATCACACAGCGGGACACACA AGGGACACGCCTACGTGCACTTCAAGTGACGAGGCGACGGCCGCGGATGTACTTCGACGGCTGGGGGAGGGCCCAACACC GACATTTCATGAGCTGTCGATCCACGTGAAGCGTGCCAGTCGTCTTGACACGGGGGAAAATAACCTGTTTATCCCCCAGC CGTTANCGCCAAAGCTCGCACACTACGCATACTCCGTGTGTGCAACTGTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1381595: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13815952655673AA676009TENF0523T.cruzi epimastigote normalized cDNA Library


Date: 15:22:29 on Thu 23 Nov 117.