EST 1381603 is a singleton


Sequence

>1381603 (1 EST) Length=384 TGAAAAGGAGTTGGAGCTAAACGACGGTCGCCGCAGCAAACTTTGCAGGGAAACACGTTTGATTTGGCCCCACGATCACC CCATCTGTGCGTTGGATAGTTGTGGTGTTCCGTGTGACAAAACCACCGTATGGAACTTTGTCAAGAGCTTTCAACGACGT CCATACCGTGCCAATGTGGGAGACTACATGGCCACCATTGGTTTCACCCCCGGCAATGCACCGGAACCACCAGAGTCTCT CAACTACGTTGAATTTTCCGTACTGATGTTAGCCCTGGCACGGCAGTAGTGCCGGGTTGCCTTTTTTTTTTTTTTTTTCC TTCCACGTCATTTGATGAANCATCTTTGGTCTACAGATGCGTACATGTAACTTTTAATTTTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1381603: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816032655681AA676017TENF0531T.cruzi epimastigote normalized cDNA Library


Date: 11:15:34 on Sun 19 Nov 117.