EST 1381612 is a singleton


Sequence

>1381612 (1 EST) Length=264 GCCTGAAGTATCTGGGTGTGTGTACAGCCTGTTCATGCGATCCCGGGGAAGCAATCAGCGACGAGGAGCTTCGCCTCCCA CCGGAACTTGAACGGATTGTCGCAATGGACTACATTTATCAGCAATCGAGACACATGAGGCGTTTTCCGTCTTCCCCCGT GCATTACAAAGAGCCTTGAGGCCCGCAGAAGAAAATGAGTTTTCCTCCAAAAAAAAAAAATATTTTTATAATTTGCCAGC AAGTAACTTTTATTGAGTTGATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1381612: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816122655690AA676026TENF0543T.cruzi epimastigote normalized cDNA Library


Date: 23:14:12 on Fri 17 Nov 117.