EST 1381618 is a singleton


Sequence

>1381618 (1 EST) Length=251 AGGAACCTTTTCTTCTGGGGTTGATTATACAGGCGGAATGCCCGCCGCGGGGGGGAACCTGCCTTTTCGTCCTGCGTCGA TTCTTTTAACGGGGTCTTTTCTGAAACGAAGCCGTGGCCTCGCATCCCTTCCTGGCGGCGCGACTGGTGGCTACTGCCGC CATCGCCAGNGGAGCGACCCCACAGCGGGGGTCCGGGGTGGCGATAGGGACAGGGTCTTCTAGCGCTCTCCGAACCGATG GGTGCCCTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1381618: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816182655696AA676032TENF0551T.cruzi epimastigote normalized cDNA Library


Date: 18:51:36 on Thu 23 Nov 117.