EST 1381625 is a singleton


Sequence

>1381625 (1 EST) Length=428 CCGACTTCAACGCCATCGCCGTCATGTACATTGGTCGCTCGCGTAAGGATGTCAAGCGACTGTATCATAGAGAACTGCGC AAACGGAGTACANGACGTGCGGGCAGCGCTGTCGTCCCGTGAGGAAATTGATCTGGGAGCGTTTAGGGCGCAATTGAAAA AGCTGGAGGAGCTTCAGCAGGTTCCAGTGCGCCACTGGAGCAGGAGGAGGAGGAGGCGCTGCGCCTTATAGAGGCGGGAG CACTGCAATTCCAGTCAACATCGAATGACGGAGAGACACCTGCTGGTGGCAGTGGAAATAAAGATTTTGAATTTGATTTT GCTGTCGTCAAAAATATGACGGCAGAAGAGATACAACCAACAAACAATGCAAAACCTGCCGATGGTGTCAAGTGTGACGA CAGCGGAGGACCAACACAAACCAAAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1381625: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816252655703AA676039TENF0558T.cruzi epimastigote normalized cDNA Library


Date: 4:15:23 on Thu 23 Nov 117.