EST 1381631 is a singleton


Sequence

>1381631 (1 EST) Length=420 TACTATATTGGGTTTGTAAACCCCTGATGCACAGCTTGACAGGAGGCCGCCACGGNTTGAATGAGCTCCACGTTTTCCTC CGAGCAATGAGCGGTGCGCACGACTTTGGGCGAAACGGATTGCCGCTCAAGAGGCCAAGGTACGGCGCTTTATGATTATG GAAGACAACTGCAGGAAAAAACTTCGGAAGAGTGTACTTCGCTCTACCAATGAACAGCTAAAATATTTGGTAAATACCGA TCTTCTGGGTGGTATGGAGTTGAAACTTCCCCCTCGTGACGCGTTCAACGCCTTCCATATCCCTACAAAACAAGTTAGTG GATTTTCCGTCTTTGCCATGGCGCGTCTCCATGCATCTCCCACTTTGATGTCAGAAATTTCACGGATAAGGTTTTATCGC CGATCTTCTCGGGAGGCATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1381631: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816312655709AA676045TENF0564T.cruzi epimastigote normalized cDNA Library


Date: 15:24:25 on Fri 24 Nov 117.