EST 1381638 is a singleton


Sequence

>1381638 (1 EST) Length=437 AAATGGCCCAAAAGAGCGGATTGGTATTGGGTGCATGTGGTGCGCTTGGAGAAGCCGTAACAAAATTACTACTGGAAAAA AAATGGAATGTAATCGGAGTGGATATCGTCCCCAAAAAACTTCTAACAGATTCTTACACACATGTTGTTTTGGACAATAT GGCCTCTGCCGAGGCCCAGCAGGGCGTGATGCTCGAAGCTGTTGCTAAAAGTACACTTTTGGATGCCGTCATCAATGTTG CCGGGGGCTGGGCAGCGGGTAGTGCAGCTGACAGTTCCGCTTCTTGTGCAATGGAATCTTTTGGATTTCCGTCAGTCGTT TGTTTTTCTTCCTATGGGCTGCCTGCCCACTTTGGTTCTCCCAAACGCGGTGGGTAAAAAACTGGTTTTNCATTTAATTG GCCAGGGTGCAAGCCGGCAGCCCTTGGGTCCAACCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1381638: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816382655716AA676052TENF0572T.cruzi epimastigote normalized cDNA Library


Date: 13:34:45 on Thu 23 Nov 117.