EST 1381643 is a singleton


Sequence

>1381643 (1 EST) Length=486 TTCCATGACTGCAGACACCCTGACCACGCTGGACGTGGTGCAGTACTACGCCTCGCAGGAGGGCTCGTCGCCGGTGGATT GGGCAAAGCGCTGGTATGAAAAGGCGTTGCTTCTACCGCTGCAAAACACACCGGAGTACAAGCAGTTGCTTGAAATTCAA CAACGTGAGCAGGCGGCATTCAAGGCGAAGGCAGAGCTCTCTGAACCGAGCGATGCCCTGGCAATTCAGGCGGAGTCGCA GGTTGCCCGGGTGAAGGTGCGGAAGGTGGTTAACATCGTGGAGAAGATGTTTATGGACCCCGGAGACAAGCGACTGGAGT CGTGGCACGAGAAGCGACTCCGGTATTTGGCTCACATGCAGATGGAACGGCAGATAAAACGCGTCCGGGAGAACTCAAAA ACTGTTCGAGGGTGTCGAATGCANCCCCCGAGGCAAGAGCATTGCCGGGAATTTTTCCAGGATTTTTATGGACCGCAAAG GGCATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1381643: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816432655721AA676057TENF0578T.cruzi epimastigote normalized cDNA Library


Date: 7:13:17 on Mon 20 Nov 117.