EST 1381645 is a singleton


Sequence

>1381645 (1 EST) Length=276 CAACTGCGCGTGTGCCGTGGCGATGCGGGATGCGGAGGGGCCAAACAGGCGCAACAACGTCAGCCTACTCATTACGGTCC CATCGCCTCATGGCAGCAGCAACGGTGACGATCGTGGCGTGAGACGTGTTCTTATCGACTGCGGCAAGACATTTCGCGAC GGTACTTCCGCGTGCTTGCAAAGCACATAGTGCAGACTGTTGACGCCCTGCTCCTCACACACGATCACGTCGACGCCGTG GGTGGCTTGGACGACATGCGCGACCTGCAGCGAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1381645: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816452655723AA676059TENF0580T.cruzi epimastigote normalized cDNA Library


Date: 22:11:21 on Sat 18 Nov 117.