EST 1381658 is a singleton


Sequence

>1381658 (1 EST) Length=403 GATTTCTCGTGCCGCGTGCTGTCCGCTCACTGCTCCTCCTGCCCCTTCCCTGTGTGTTGTCTTTGTGTTTGGTGAAGATC CTGCTGAGAGTGCACGAAAGGAATTTAAGGGACGCAAAACATGTCTGACGCTGCCGTTCCGCCCAAGAAGGCCTCGCCGA AGAAGGCCGCGCCGAAGAAGGCAGTGGCTAAGGGGACTCCCGCCAAGAAGACTGCTAGGAAACCAGCCGTGAAGAAGCCT GCTGCGAAGAAGGCGCCGAAGAAGTAGGGATTTATTTTGGCTCAACCGTGCGTTCTCGCGATCCGTGTCGCTGGCGCACC TGGTAGATAACGGTATGAACTTGTCACCGGTGGNGACGACGTCATGCCCGTTTTTCCATTACTAGAACTCTTGTTTCGTT TTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1381658: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816582655736AA676072TENF0598T.cruzi epimastigote normalized cDNA Library


Date: 16:16:21 on Tue 21 Nov 117.