EST 1381659 is a singleton


Sequence

>1381659 (1 EST) Length=421 GTAAGGGAGATGAGGAGGAGAGTGTGTGACTTTGTGGCCCACGCGTTGCTGGGGACCGTTGTTGTTGTGTGTCCGTGCAT GCCTGCGGGTTGTTGGGGCTGGCACTGGTCACCGCCCGCCGCCGTCGCCGGAACACGAAAGGTTCAGGCAAGTGAAGGAA AGGACGACAGGAGTCTCCACGTGGCCCTCACCACAATTGAGGCACAACCCGCATAGCGACTTTGCTTCCGAGGGCGGCTG TCTCCGCCGCGCAGGAGGAGAATGCCATCGAGAAACAGTGCACCGTGTCTCAAAATGGCGCGCACACATCCATTCATCAA CGCCACACTGTCGCCGATTTCATGATGGCCGAGGGTCAGGCCACCGAGAAAGCGCACGTCGCCTGCCGGTCGACAACCCG ATAAGATNAACACCGGTGGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1381659: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816592655737AA676073TENF0599T.cruzi epimastigote normalized cDNA Library


Date: 7:1:12 on Mon 20 Nov 117.