EST 1381660 is a singleton


Sequence

>1381660 (1 EST) Length=256 ACAACACAAACAGACGCAACATCATGCTCAAACTCCTCCATCTCCGCCTTGCATAATGCATAGAACAAGTCGTGATGAAG GGAATTGCTGGGAAAGTGCAGTTGCAGACTCTTCTTCTCTATACCCCACCGGATGGCAGTGGCTGTCTCGCTCCCATCAA ACGATTTTTCTAGGAATAACAGAATACAACCAACAAAACCCAAAATTACAAGAGGGAGCAGAGAAAAATTTAAAATTAAA ATTAAAATNTTTATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1381660: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816602655738AA676074TENF0600T.cruzi epimastigote normalized cDNA Library


Date: 8:49:21 on Fri 24 Nov 117.