EST 1381661 is a singleton


Sequence

>1381661 (1 EST) Length=229 GGAGGAACATATTACAGTCATGCAGAATGTTTTTGCTCAGATAGGGACTCTCGATTTTGATGGTATTAGAAAAATGTGGA CTTCAGTGATTATACCTCAACTGCGCACTCCATAAGTGGTGGCGCTCTTGTTAATGATAGTCAGAATCTGCTACAAAATT GGAGGAAGCGTCGTTTTTGCCATAATGGGAGTGGCCGTAAGGAACCGTTGTCCTCCAAATTTGGGCCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1381661: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816612655739AA676075TENF0601T.cruzi epimastigote normalized cDNA Library


Date: 0:39:29 on Thu 23 Nov 117.