EST 1381662 is a singleton


Sequence

>1381662 (1 EST) Length=247 TGTGTAACAACGGAGAGCTTCGATAACAATAGTAAAAACGTGAGGAGCAGGCCTGAAGGAAAATAACACACACACACACG GAATTAATAAGGGATTATGGATACTGTGGCTCTCACCGTCAGCTCACTTGTACATCAGGGTGAGACTTTTACATTTCCGG TTGTCCGTAGCAAGTCTTTGGCAGTCACTGTCGCCGTAGTATTCCCCTCGCGGTGCTCCTGCATGAAACGGCAGACCGCT GGTTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1381662: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816622655740AA676076TENF0603T.cruzi epimastigote normalized cDNA Library


Date: 17:17:14 on Wed 22 Nov 117.