EST 1381665 is a singleton


Sequence

>1381665 (1 EST) Length=399 CCTCTCCCTCAGCAAAATGTATATTTTGCTTGAGCTTACATTTCATTTTCTTTTCTTCTGTTTCTTTTTCTTCTTTCTTT TTTGTTTTCCTCCTCTCTCTCTCTCTCTTCCTCTCTCCCTCTCTCGCTCTTTATCTTCTGTGTGTAGCTCATGGCCATGT AAACGGCTCCGGTGGCGGTGCATCGTCGGCGCTGTTCCAGCCCACTTCACTCACAATCTTCTGCTTGCCGTCTGAGGGCT TTGTATCGCGCAAGACAGATACCCGTTGGGTGAGGTTAAAGTGGCAGTAGCGTCAATCCAAATCGGTGAGATCACAGCGA ACTGTCGGGACGTAACACGGGTCGGGTTTTCAAGGAGTCAAAGAAGGGTCGGCCTTTCTTTCCCGGTCCGCCCAAAGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1381665: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816652655743AA676079TENF0606T.cruzi epimastigote normalized cDNA Library


Date: 21:13:53 on Fri 24 Nov 117.