EST 1381667 is a singleton


Sequence

>1381667 (1 EST) Length=284 TTTCTGTACTATATTGAGTGAAAAGGGAATACGCATGCAGGATGTCTTTGAGTTGTTATCTTCGCTTGCCTATTGGACTG ATCGTTGTGCTGTTTTTATGCACACAGACCTTTGGACCTCCTGTGGCGGACAGCAGATTTCGGAGTCCATACGTTCGATC ACTGCCCAGTACAAAAAACTTGTNGAGAGGGCGATAAATGAAACAATGCGAAGTTTGATGGATCACTTGGATTCCAACCG CGACGGTCAGATCCAGCTGGAGGAGTTTCAAAGTCTTGCGGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1381667: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816672655745AA676081TENF0609T.cruzi epimastigote normalized cDNA Library


Date: 23:4:45 on Wed 22 Nov 117.