EST 1381672 is a singleton


Sequence

>1381672 (1 EST) Length=409 CCATCATTCCCGCATGACGAACCGTTGCTGCAGCCGCTTTGGACGTTTATTGTGAGTTGCGCGGAGGCGAATGGCGGCGG TGTGCGTGGCACTGAGCTCATTCGCCAACAGCGATGTCGTCTTGTGCAGATGTCACCTGCCCTTGCGGCCCTCATGATGG CCTTCACGCGGAGTTCACCGTACGGGCCATCATGACGTATGATCTCACTCACACCCACACCCACACACACACACACTCTC TCTCTCTTTTCATCGGTGTTTATGGTTAGAAGGGAACAGAGACAAAATTGCACACATGGCGGCTGCCGTGTCTCTGATGG TGATGATGTCCCACGAGGAAAAGGGGGAGAAGGCAAGAAAAAAAAAAAACAACTGGACCATAACCAGAGGATTGCATACA TGCACATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1381672: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816722655750AA676086TENF0617T.cruzi epimastigote normalized cDNA Library


Date: 0:24:29 on Thu 23 Nov 117.